英语翻译MATERIALS AND METHODSGenetic stocks and growth condition

英语翻译
MATERIALS AND METHODS
Genetic stocks and growth conditions
With one exception,all of the genetic stocks described in this paper were in
Columbia background.The T-DNA insertion SALK_035860 was obtained
from the Arabidopsis Biological Resource Center.The insertion
FLAG_173C12 was obtained from the FST project and was characterized
in a Ws genetic background.Plants homozygous for these insertions were
identified by PCR using allele-specific primers.Seeds were grown on
Metromix 200 (Scotts) and left in 4°C cold room for 2 days before transfer
to growth chambers.Plant age was measured from the time seeds were
transferred to the growth chamber.For phenotypic analysis,plants were
grown in 96-well flats under continuous fluorescent light (100
3E/minute/m2; Sylvania VHO) at 22°C.Abaxial trichomes were scored 2
weeks after planting with a stereomicroscope.Flowering time represents the
appearance of the first open flower.
RNA blots
Total RNA was isolated using Trizol (Invitrogen) from shoot apices of plants
grown under short-day conditions (10 hours light:14 hours dark) at 22°C.
Whole seedlings (including cotyledons) were used for 8- to 14-day-old
seedlings,the cotyledons and leaves 1 and 2 were removed from plants
harvested between 18-21 days after planting (dap),and the cotyledons and
leaves 1-4 were removed from plants harvested between 23-28 dap.The
number of leaves present on the shoot apex was determined by comparison
with a growth curve generated by dissecting shoot apices grown under the
same SD conditions.To measure SPL3 mRNA,20 3g of total RNA was run
on 1.2% agarose gels,transferred to Hybond N+ nylon membranes
(Amersham Pharmacia),and crosslinked under UV light.Hybridizations
were performed at 68°C in PerfectHyb plus buffer (Sigma).The SPL3 probe
was PCR amplified using the primers 52 ACGAGAGAAGGCGGAAAAGCACAA
32 and 52 CGGGATCCCTAAGTCTCAATGCATTTAT 32
from a SPL3 cDNA clone and was labeled with 32P-dCTP using Prime-II
Random Primer Labeling Kit (Stratagene).Blots were hybridized for 8 hours
at 68°C,washed once in 24SSC and 0.1% SDS solution for 5 minutes at
room temperature,twice in 0.54SSC and 0.1% SDS for 20 minutes at 68°C,
and once in 0.14SSC and 0.1% SDS for 20 minutes at 68°C,and were
scanned with a Storm 860 (Molecular Dynamics).To measure miR156,50
3g total RNA was separated on 8 M urea/15% denaturing polyacrylamidegels and electrically transferred to Hybond N+ nylon membranes.Blots were
hybridized with a miR156-complementary oligonucleotide labeled with 32PATP
(New England Biolabs) at 40°C in ULTRAhyb-oligo hybridization
buffer (Ambion,Austin,TX).Blots were washed twice at 40°C in 24SSC
and 0.5% SDS for 30 minutes before scanning.
52 and 32RACE
Total RNA was isolated from leaf or floral tissue as described above.